A restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA.
100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
This is a homing endonuclease and requires 3 hour incubation periods
Tolerates some sequence degeneracy within recognition sequence
Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Product Information
The intron encoding I-CeuI is present in the chloroplast large rRNA gene of Chlamydomonas eugametos. This gene has been cloned and overexpressed in E. coli.
Product Source
An E. coli strain that carries the I-CeuI gene from Chlamydomonas eugametos (C. Lemieux).
Price | 467,50 RON (preturile sunt fara TVA) |
---|---|
Description |
100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests Product Information |