R0696S,  PI-Sce I (VDE) - 250 units

R0696S, PI-Sce I (VDE) - 250 units

R0699S,  I-CeuI (Intron encoded endonuclease), recombinant - 500 units

R0699S, I-CeuI (Intron encoded endonuclease), recombinant - 500 units

R0699L, I-CeuI (Intron encoded endonuclease), recombinant - 2.500 units

2.548,98 RON

A restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA.

SKU
NEB_R0699L

100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
This is a homing endonuclease and requires 3 hour incubation periods
Tolerates some sequence degeneracy within recognition sequence
Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)

Product Information
The intron encoding I-CeuI is present in the chloroplast large rRNA gene of Chlamydomonas eugametos. This gene has been cloned and overexpressed in E. coli.
Product Source
An E. coli strain that carries the I-CeuI gene from Chlamydomonas eugametos (C. Lemieux).

Mai multe informatii
Price 2.142,00 RON (preturile sunt fara TVA)
Description

100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
This is a homing endonuclease and requires 3 hour incubation periods
Tolerates some sequence degeneracy within recognition sequence
Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)

Product Information
The intron encoding I-CeuI is present in the chloroplast large rRNA gene of Chlamydomonas eugametos. This gene has been cloned and overexpressed in E. coli.
Product Source
An E. coli strain that carries the I-CeuI gene from Chlamydomonas eugametos (C. Lemieux).