R0582S,  TspR I, recombinant - 1.000 units

R0582S, TspR I, recombinant - 1.000 units

R0708S,  BaeG I - 500 units

R0708S, BaeG I - 500 units

R0695S, PI-Psp I, recombinant - 500 units

599,76 RON

A restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT.

SKU
NEB_R0695S

A restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT.

  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)

 

PI-PspI is obtained from a strain of E. coli which expresses the DNA polymerase from the extreme thermophile, Pyrococcus species GB-D (1). PI-PspI is a product of in vivo protein splicing that gives rise to both polymerase and endonuclease from a single polypeptide precursor.

Product Source

An E. coli strain that carries the PI-PspI gene from Pyrococcus species (H.W. Jannasch).

Mai multe informatii
Price 504,00 RON (preturile sunt fara TVA)
Description

A restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT.

  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)

 

PI-PspI is obtained from a strain of E. coli which expresses the DNA polymerase from the extreme thermophile, Pyrococcus species GB-D (1). PI-PspI is a product of in vivo protein splicing that gives rise to both polymerase and endonuclease from a single polypeptide precursor.

Product Source

An E. coli strain that carries the PI-PspI gene from Pyrococcus species (H.W. Jannasch).