Limba
Romanian
Romanian
English|
R0695S, PI-Psp I, recombinant - 500 units
536,69 RON
A restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT.
SKU
NEB_R0695S
A restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT.
- This is a homing endonuclease
- Tolerates some sequence degeneracy within recognition sequence
- Restriction Enzyme Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-PspI is obtained from a strain of E. coli which expresses the DNA polymerase from the extreme thermophile, Pyrococcus species GB-D (1). PI-PspI is a product of in vivo protein splicing that gives rise to both polymerase and endonuclease from a single polypeptide precursor.
Product Source
An E. coli strain that carries the PI-PspI gene from Pyrococcus species (H.W. Jannasch).
| Price | 451,00 RON (preturile sunt fara TVA) |
|---|---|
| Description |
A restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT.
PI-PspI is obtained from a strain of E. coli which expresses the DNA polymerase from the extreme thermophile, Pyrococcus species GB-D (1). PI-PspI is a product of in vivo protein splicing that gives rise to both polymerase and endonuclease from a single polypeptide precursor. Product SourceAn E. coli strain that carries the PI-PspI gene from Pyrococcus species (H.W. Jannasch). |
