D6424-PS1, Quick-ITS Plus NGS Library Prep Kit with Primer Set 1 (96 rxns)

D6424-PS1, Quick-ITS Plus NGS Library Prep Kit with Primer Set 1 (96 rxns)

D6424-PS3, Quick-ITS Plus NGS Library Prep Kit with Primer Set 3 (96 rxns)

D6424-PS3, Quick-ITS Plus NGS Library Prep Kit with Primer Set 3 (96 rxns)

D6424-PS2, Quick-ITS Plus NGS Library Prep Kit with Primer Set 2 (96 rxns)

8.895,25 RON

The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

SKU
ZR_D6424-PS2
HIGHLIGHTS

  • The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
  • 100% automation ready with only a single PCR step and without the need for normalization.
  • Real-time PCR enables absolute microbial copy number quantification.
DESCRIPTION

The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

TECHNICAL SPECIFICATIONS

Amplicon Size The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp.
Barcode Sequences 10 bp barcodes, Available for download here (USA Only), or under the Documents section as "Barcode Sequences".
Index Primers Dual index (barcodes) to uniquely label samples.
ITS Primer Sequences (adapters not included)
ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp).
Required Equipment Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.
Sample Input Purified microbial DNA ≤100 ng, free of PCR inhibitors.
Sequencing Platform Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F.

Mai multe informatii

Mai multe informatii
Price 7.475,00 RON (preturile sunt fara TVA)
Description
HIGHLIGHTS

  • The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
  • 100% automation ready with only a single PCR step and without the need for normalization.
  • Real-time PCR enables absolute microbial copy number quantification.
DESCRIPTION

The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

TECHNICAL SPECIFICATIONS

Amplicon Size The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp.
Barcode Sequences 10 bp barcodes, Available for download here (USA Only), or under the Documents section as "Barcode Sequences".
Index Primers Dual index (barcodes) to uniquely label samples.
ITS Primer Sequences (adapters not included)
ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp).
Required Equipment Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.
Sample Input Purified microbial DNA ≤100 ng, free of PCR inhibitors.
Sequencing Platform Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F.