Pagina principala
Cautati rezultate pentru: 'hela mix 120 3p ugugcaaauccaugcaaaacuga 40 ngal eurogentec'

Cautati rezultate pentru: 'hela mix 120 3p ugugcaaauccaugcaaaacuga 40 ngal eurogentec'

Related search terms: 1200 watt 1 sputter ne kodak year; 1200 watt 1 state ne kodak year; hela http; 1200 watt 1 state ne kodak yap1; 1200 watt 1 state ne kodak yakima

Adaugati pentru comparare

LS-C203042-40, Vimentin Antibody (aa70-120) LS-C203042, Weight: 40 µg, Volume: 80 µl, Concentration: 0.5 mg/ml TVA inclus
2.493,05 RON
Adaugati pentru comparare

LS-C203049-40, TRF1 / TERF1 Antibody (aa70-120) LS-C203049, Weight: 40 µg, Volume: 80 µl, Concentration: 0.5 mg/ml TVA inclus
2.493,05 RON
Adaugati pentru comparare

N0447L, Deoxynucleotide Solutions, Mix - 40 µmol of each TVA inclus
1.852,24 RON
Adaugati pentru comparare

70535-04, Aluminum for PCR or storage, -40° to 120°C, 100 Pack TVA inclus
718,46 RON
Adaugati pentru comparare

5' Phosphate 40 nmol scale, 1 modification TVA inclus
229,19 RON
Adaugati pentru comparare

HeLa cell line stably expressing FLAG-HA tagged histone H2A, 1 million cells TVA inclus
4.581,50 RON
Adaugati pentru comparare

HeLa cell line stably expressing FLAG-HA tagged histone H2B, 1 million cells TVA inclus
4.581,50 RON
Adaugati pentru comparare

HeLa cell line stably expressing FLAG-HA tagged histone H4, 1 million cells TVA inclus
4.581,50 RON
Adaugati pentru comparare

HeLa cell line stably expressing FLAG-HA tagged histone H3.1, 1 million cells TVA inclus
4.581,50 RON
Adaugati pentru comparare

5' ATTO 465 40 nmol scale, 1 modification TVA inclus
1.320,90 RON
Adaugati pentru comparare

HeLa cell line stably expressing FLAG-HA tagged histone variant H2A.X, 1 million cells TVA inclus
4.581,50 RON
Adaugati pentru comparare

HeLa cell line stably expressing FLAG-HA tagged histone variant H2A.Z, 1 million cells TVA inclus
4.581,50 RON